snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA16
sequence
TGTGGCCCTTATCGAAGCTGCAGCAGCTTCTACATAGCTGCTGTGGTCAAAAAGGTGGC
CCAGAGAAAGAATTTTCCTTGACGGTCGCAGTTCTGTTTCCTGTAACTGATCTGCAACAT
TGTGGAAAATGACAGCT
  Box motif
  Complementary to target RNA
length 136
organism Mus_musculus
snoRNA name SNORA16
alias ACA16
chromosome ⁄ contig 4
locus ⁄ host gene Poly:15:SNORA16
organization Poly
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4094
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved