snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD14
sequence
TCACAGTGATGATGGTGTTCCAACATTCGCAGTTTCCACCAGAAGGACTTTCCATGTTG
GGTTGACCTTCCTTGGATGTCTGAGTGA
  Box motif
  Complementary to target RNA
length 87
organism Mus_musculus
snoRNA name SNORD14
alias
chromosome ⁄ contig 7
locus ⁄ host gene Mono:62:SNORD14
organization Mono
target RNA 18S rRNA
modification type C/D
modification site 18S:C463
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved