snOPY snoRNA Orthological Gene Database
Mus_musculus snoZ30
sequence
ATGCAATGATGAGCGAAGTATAGTCTGACCTGGTATTGCCATTGCTTTGGCGCTGGCTC
TGACCAGGGTGTGACCCCTTAATCTTCTCTCTGAGCTG
  Box motif
  Complementary to target RNA
length 97
organism Mus_musculus
snoRNA name snoZ30
alias
chromosome ⁄ contig 11
locus ⁄ host gene Mono:443:snoZ30
organization Mono
target RNA U6 snRNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved