snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA25
sequence
AGGTCATTTCAAAGAGGGCTTTTTGGGCTATAAAACCCACAGCTCTTAACGCTGTGACC
AAAGATTGATGTTCTTCACAGAGAAAATCCTGCACTGTTTTGATAGTGCTGTGTTTTTCT
GAGAAGATAACATA
  Box motif
  Complementary to target RNA
length 133
organism Mus_musculus
snoRNA name SNORA25
alias ACA25
chromosome ⁄ contig 9
locus ⁄ host gene Poly:9:SNORA40
organization Poly
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U802
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved