snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORA25
sequence
TGGTCATTTCAAAGAGGGCTCATGGAGTTGTGAAACCAAGAGCTCTTAACGCTGTGACC
AAATATTGAAGTTCTCTGCAGGATGTTGTAACACTAAATAGTGCTATGTTTTCCTGAGGA
GAGGTACAA
  Box motif
  Complementary to target RNA
length 128
organism Microcebus_murinus
snoRNA name SNORA25
alias
chromosome ⁄ contig scaffold_2279
locus ⁄ host gene Poly:0:SNORA25
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved