snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORA55
sequence
GCACCTGAATCTTTCCCATTCTCTGCTGCCTCGTGCTGGTGTGGGGACAGACGGTGCTA
CAACACGAGCAGAGGAAATCCAGACGGGTTGTTCGCATTTGTCTTGGGGCCTGTCTCTAC
AACTCTGCCACACTC
  Box motif
  Complementary to target RNA
length 134
organism Loxodonta_africana
snoRNA name SNORA55
alias
chromosome ⁄ contig GeneScaffold_991
locus ⁄ host gene PABPC4
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved