snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORD82
sequence
AGCGCAAATGATGAACAACAAAGGGACTTAATGCTGAAACCTGATGTTACGTTGTGATG
CTGATATGTGC
  Box motif
  Complementary to target RNA
length 70
organism Loxodonta_africana
snoRNA name SNORD82
alias
chromosome ⁄ contig GeneScaffold_2123
locus ⁄ host gene NCL
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved