snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORD103
sequence
TTGTCTGGCAGTGATGACCCACTTGCCCTCACTGAGAACAAAGTTCGGTAATGAGAATC
TTAGTTATGGACTCAGGTTCTGAGCCAGACA
  Box motif
  Complementary to target RNA
length 90
organism Loxodonta_africana
snoRNA name SNORD103
alias
chromosome ⁄ contig GeneScaffold_3190
locus ⁄ host gene PUM1
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved