snOPY snoRNA Orthological Gene Database

Family: SNORD103

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300397 -----CTCCCTCAGCCTTACTCCCGGGC-CTT--TT-GCT--GTGAAGTG C_porcellus300843 -----CGTCCTCAGCCTTACTCCAGGGCCTTT--G----CT-GTGAAGTG D_novemcinctus300559 -----CTTCCTCAGCCTTACTCCAGGGGCTTT--TGTGCCT-GTAGAGTG E_telfairi300116 -----CTTCCTCAGCCTTTCTCCAGGGCCTTC--T-CGC-T-GTGGAGTG E_telfairi300145 -----TCCTCTCAGCCTTACTCCAGGGCCTTC--T-CGC-T-GTAGAGTG E_telfairi300802 -----CTTCCTCAGCCTTACTCCTGGGCCTTC--T-CGC-T-GTGGAGTG E_caballus300278 -----CTCCCTCAGCCTTACTCCAGGGA-CTT--TT-GCT--GTAAAGTG E_europaeus300719 -----CTCCCTCAGCCTTACTCCAAGGG-CTT--TG-TCCT-GTGAAGTG F_catus300267 -----CTCCCTCAGCCTTACTCCGGAGC-CTT--TT-GCC--GTGAAGTG H_sapiens300697 -----CTTCCTCAGCCTTACTCCAGGGACTTTTTGTTGCCT-GTAAAGTG L_africana300456 -----CTTCCTCAGCCTTACTCCAGAGCCTTC--T-CACCT-GTAGAGTG M_mulatta300631 -----CTTCCTCAGCCTTACTCCAGGGGCTTTTTGTTGCCT-GTAAAGTG M_murinus300432 -----CTTCCTCACCCTTACTCTGGGGGCTTTATTTCATCT-ATGAAGCG M_murinus300527 -----ATTCCTCAGCCTTACTCCGGGGGCTTT--TGTGCC--GTAAAGCG M_domestica300148 -----CTTCCTCAGCCTTACTCCAGGGACTTT--CTTGTCC-ATAGAGTG M_musculus300775 -----CTTCCTCAGCCTTACTCCAGGGGCTTC--T-TGCCT-GTAGAGTG O_anatinus302259 -----CTTCCTCAGCCTTACTCCAGGGGCTTT--CTTGCTC-ATAGAGTG O_cuniculus300239 -----AGTCATAATGTTTTATTATAAAAATTTAC------TGTTTTAGTG O_cuniculus300443 -----CTTCCTCAGCCTTACTCCAGGGTGGTT--TT-GCCT-GTAAAGTG O_garnettii300023 -----ACTCCTCAGCCTTCCTCCAAGGGCTCA----TGCCT-GCTGAGTG O_garnettii300345 -----ACTCCTCAGCCTTCCTC-AAGGGCTCA----TGCCT-GCTGAGTG O_garnettii300389 ------------------------------TTA--------CCTA-AGCC O_garnettii300625 -------CCATCACAGCCTACAAAGGAACTTCA--------AATACAGAA O_garnettii300666 -----CTTCCTCAGCCTGACTCCAGGGGCTTTATTTTGTCTTGTGAAATG P_troglodytes300655 -----CTTCCTCAGCCTTACTCCAGGGACTTTTTGTTGCCT-GTAAAGTG P_pygmaeus300655 -----CTTCCTCAGCCTTACTCCAGGGGCTTTTTGTTCCCT-GTAAAGTG R_norvegicus301025 -----CTTCCTCAGCCTTACTCCAGGGGCTTC--T-TGCCT-GTAGAGTG S_araneus300228 TTCCCTCATCTAAATTCTATCCCAGGGGCTTT--TT-GCCT-GTAGAGTG S_araneus300681 -----TTCCCTCTGTCTTCCTCCAGGGG-TTT--TT-GCCT-GTAGAGTG S_araneus300917 -----CTCCCTCAGCCTTACTCCAGGGG-CTT--TT-GCCT-GTAGAGTG S_tridecemlineatus300267 -----CGTCCTCAGCCTTACTCCAGGGGCTTT--TTTGCCT-GTGAAGTG T_belangeri300061 -----CTTCCTCAGCCTTACTCCAGGGGCTTT--CT-GCCC-GTAGAGTG T_belangeri300063 -----CATCCTTAGCCTTACTCCAGGGGTTTT--CT-GCCC-GTAGAGTG * C_familiaris300397 CCCCG-----GCATTGCCTGAGGGTA-----CAGGACCGAGCACACGTCC C_porcellus300843 CCTTG-----GCATTGCCTGAGGATA-----CATGAGAAAGCACATCTCC D_novemcinctus300559 CCCTG-----GCATTGCCTGAGGACA-----GAGGAGAAAGCACATGTCC E_telfairi300116 CCCGG-----GCATTGCCTGAGGATA-----GATAAGAAAGCCCGTGTCC E_telfairi300145 ACCGG-----GCATTGCCTGAGGATA-----GATAAGAAAGGCCGTGTCC E_telfairi300802 CCCTG-----GCATTGCCTGAGGATA-----GATAAGAAAGCCCGTGTCC E_caballus300278 CCCTG-----GCATTGCCTGAGGGCA-----CATGAAAAAGCACATATCC E_europaeus300719 CCTTG-----GCATTGCCTGAGGGAA------CAGCAACAGCACACCTCC F_catus300267 CTCCG-----GCATTGCCTGAGGGTA-----CAGGACCGAGCACACGTCC H_sapiens300697 CTCTG-----GCATTGCCTGAGGATA-----GATGAGAAAGCACATATCC L_africana300456 CCCTG-----GCATTGCCTGAGGATA-----GATGAGAAAGCACGTGTCC M_mulatta300631 CCCTG-----GCATTGCCTGAGGATA-----GATGAGAAAGCACATGTCC M_murinus300432 CCCTG-----GTATTGCCTGAGGACA-----GATGAGAAAGCACACGACC M_murinus300527 CCCTG-----GCATTGCCTGAGGATA-----GACGAGGAAGCACACGTCC M_domestica300148 CCCTG-----GCATTGCCTGAGGAGA-----AAGCAGAAAGCACATTTCC M_musculus300775 CCCTG-----GCATTGCCTGAGGATA-----GAGGAGAAAGCACAGCTCC O_anatinus302259 CCCTG-----GCATTGCCTGAGGATA-----AATCAAAAAGCCCATATCC O_cuniculus300239 CCCTG-----GCATTGCCTAAGGATA-----GATAAGAAAGCACAAATCC O_cuniculus300443 CCCTG-----GCATTGCCTGAGGATA-----GATGAGAAAGCACAGATCC O_garnettii300023 CCCTG-----GCATTGTCTGAGGATA-----GTCCAGCAAGCACCGT--C O_garnettii300345 CCCTG-----GCATTGTCTGAGGATA-----GTCCAGCAAGCACCGT--C O_garnettii300389 T---G-----GCATTGCCCGAGGATG-----GACGAGCAAGCACACATCC O_garnettii300625 C---A-----TCATTGCCTGAGGATA-----GACAAGCAAGCTCACGTCC O_garnettii300666 CCCTG-----GTATTGCCTGAGGATA-----GACGAGAAAGCACATGTCC P_troglodytes300655 CTCTG-----GCATTGCCTGAGGATA-----GATGAGAAAGCACATATCC P_pygmaeus300655 CCCTG-----GCATTGCCTGAGGATA-----GATGAGAAAGCACATATCC R_norvegicus301025 CCCTG-----GCATTGCCTGAGGATA-----GAGGAGAAAGCACAGCTCC S_araneus300228 CTCTG-----GCATTACCTGAGGGTA-ATGTGTGGGAAAAGTGCAATTCC S_araneus300681 CCCTG-----GCAATGACTGAGGGTACAGGAAAAGGAAAAGTAGACTTCC S_araneus300917 CCCTG-----GCATTGCCTGAGGGTA------CAGGAAAAGCGCACTTCC S_tridecemlineatus300267 CCCTG-----GCATTGCCTGAGGATA-----TAAGAGAAAGCACGTG--C T_belangeri300061 CCCTG-----GCATTGCCTGAGGAGA-----CAGC-GAGAGCACGTTTCC T_belangeri300063 CCCTGCCCTGACATTGCCTGAGGAGA-----GAGC-GAGAGCACGTTCCC * * * *** ** * C_familiaris300397 CTCCCC-AGGAAGACTCTG---TGTTCTCGTGGGGCCTACGAGTTGAGCT C_porcellus300843 CTCCCC-AGCAAGACGCTG--CTTT-CTTGTGGGGCCTACAGACTGTGCT D_novemcinctus300559 CTCCCC-AGTAAGAACCTG--CTTT-CTTTTGGGGTCTACACATTGAGCT E_telfairi300116 CTCCCC-AGGAAGCACCCA--CTTT-CTTCTGGGGCCTACACATTGAGCT E_telfairi300145 CTCCCC-AGGAAGAACCCA--CTTT-CTTCTGGGGCCTACACACTGAGCT E_telfairi300802 CTCCCC-AGGAAGAACCCA--CTTTTCTTCTGGGGCCTACACATTGAGCT E_caballus300278 CTCCCC-AGTAAGACTCTG---TGTTCTTGTGGGGCCTACAGATTGAGCT E_europaeus300719 CTCCCC-AGGAAGATTCTG---TTCTCCTGTGGGGCCTGCAGCCTGCGCT F_catus300267 CTCCCC-AGGAAGACTCTG---TGTTCTCGTGGGGCCCACGGGTTGAGCT H_sapiens300697 CTCCCC-AGTAAGACGCTG---TTTTCTTTTGGGGCCTACAAGTTGAGCT L_africana300456 CTCCCC-AGGAAGAATCCG--CTTT-CTTCTGGGGCCTACACATTGAGCT M_mulatta300631 CTCCCC-AGTAAGACGCTG---TTTTCTTTTGGGGCCTACAAGGTGAGCT M_murinus300432 TTCCCC-AGTCA--CTCTG---TTTTCTTCTGGGGCCTACACGTGGAGCT M_murinus300527 CTCCCC-AGCAAGACTCCG---CTTTCTTTTGGGGCCTGCAGGTGGAGCT M_domestica300148 CTCCCC-ATTAAGAGCCTG--ATCTTCTTTTGGGGCCTACATTTGGAGCT M_musculus300775 CTCCCT-AGCAAGACTCTG--CTTT-CTTGTGGGGCCTACAGATTGGGCT O_anatinus302259 CTCCCC-AGTAGGAGCCTG--ATTTTCCTTTGGGGCCTACAGTTTGGGCT O_cuniculus300239 CTTCCC-ACGAAGATTCAAACTTCTTCTTCTGAGGCCTACAGATTGACCT O_cuniculus300443 CTCCCC-AGGAAGATT-TG--AACTTCTTTTGGGGCCTACAGTTTGAGCT O_garnettii300023 CTCCCC-AGTGAGACTCTG---CTAACTTTTGGGGCCTGCTAGGTGAGCT O_garnettii300345 CTCCCC-AGTGAGACTCTG---CTAACTTTTGGGGCCTGCTAGGTGAGCT O_garnettii300389 CTCCCC-AGTAAAACCC---CGCTATCTTTGGGGGCCTAGAAGGTGCGCT O_garnettii300625 CTCCCCCAGTAAGACTT---TGCTATCTTTTGGGGCCTACAAGGTGAGCT O_garnettii300666 TTCTCT-GCCAAGACTCTG---TTTTCTTTAAGGGCCTACGCGTTAAGCT P_troglodytes300655 CTCCCC-AGTAAGACGCTG---TTTTCTTTTGGGGCCTACAAGTTGAGCT P_pygmaeus300655 CTCCCC-AGTAAGACACTG---TTTTCTTTTGGGGCCTACAAGTTGAGCT R_norvegicus301025 CTCCCT-AGCAAGACTCTG--CTTT-CTTGTGGGGCCTACAGATTGGGCT S_araneus300228 CT-TCC-AGGAAGACTAT------TTCTATTTGGGCCTACAAGGTGAGTT S_araneus300681 TTCTTC-AGGATGACCAT------TTCCATTGGGACCTACAAGGTGA-CT S_araneus300917 CTCCCC-AGGAAGACTGT------GTCCACTGGGGCCTACAAGGTGAGCT S_tridecemlineatus300267 CTCCCC-A-CAAGGCTCTG---ATCTCGT----GGGCCACAGGCTGAGCT T_belangeri300061 CTCCCC-AGGAAGACACTG----T--TCTGTGGGGCCTA-AAAC-GAGCT T_belangeri300063 CTCCCC-AGAAACATGCTG----TGTTCTGTGAGGCCTATGAAT-GAGTT * * * * C_familiaris300397 GACAGT- C_porcellus300843 GACAAC- D_novemcinctus300559 GACAGG- E_telfairi300116 GACAGT- E_telfairi300145 AACAGT- E_telfairi300802 AACAGT- E_caballus300278 GACAGT- E_europaeus300719 GACAGC- F_catus300267 GACAGT- H_sapiens300697 GACAGTA L_africana300456 GACAGT- M_mulatta300631 GACAGT- M_murinus300432 GACAGG- M_murinus300527 GACAGT- M_domestica300148 GACATT- M_musculus300775 GACAGC- O_anatinus302259 GACACA- O_cuniculus300239 AATAGC- O_cuniculus300443 GACAGT- O_garnettii300023 GATGGT- O_garnettii300345 GATGGT- O_garnettii300389 GACAGT- O_garnettii300625 GACAGT- O_garnettii300666 GACAGT- P_troglodytes300655 GACAGT- P_pygmaeus300655 GACAGT- R_norvegicus301025 GACAGC- S_araneus300228 GACAGT- S_araneus300681 GACAGT- S_araneus300917 GACAGC- S_tridecemlineatus300267 GACAGT- T_belangeri300061 GACAGG- T_belangeri300063 GACAGT- *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved