snOPY snoRNA Orthological Gene Database
Homo_sapiens SCARNA6
sequence
GGTCAATGATGAATGGTAAAAGGTCTGAGTCCTCAGATCCCCTCCCGGCATCCCAGTTA
TCCCCAGCTGCCTCTCCTCCATCGCACTTCAGAAGTGCTGCGATGGGCAGAAGGGCAGCT
GACACTCCGTGATGTCCCTCATTCTGTGTTCCTCCGTGAGCTCAGGGAAGACACTGGTTG
GCATCCAACAGCTTAGTCACAAAGGGATTTGATTGTTGGGAGTGCTGGTATCTGTGGCTA
TGATCTGCCTTGTTCAAGCTGAGACCT
  Box motif
  Complementary to target RNA
length 266
organism Homo_sapiens
snoRNA name SCARNA6
alias U88
chromosome ⁄ contig 2
locus ⁄ host gene ATG16
organization Intronic
target RNA U5 snRNA
modification type C/D
modification site U5:U41
accession no NR_003006 NT_005120
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved