snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA25
sequence
AGGATATATCAAAGAGACTTTCTGGGGCTGGGAAACCAGGATCTCGTAATGCTATGACC
AAAGATTGAAGTTTTGCATAGGATACCGTAGTCACTCAGTAGTGCTGTTTTCCTGAGGAA
ATACAAGA
  Box motif
  Complementary to target RNA
length 127
organism Homo_sapiens
snoRNA name SNORA25
alias
chromosome ⁄ contig 8
locus ⁄ host gene FAM49B
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U801,18S:U814
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved