snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA16B
sequence
TATGGCCTTTATCAAAGCTGCAGCTGCTTCCATGTAGCTGCTGTGGTCAAAAAGAAGCC
AAGAGTGACAGTTTTCCTTGATGGTCATAGTTCTGTTTGCTGTAACTGATCTGCAAGATT
TTGGGAAAATACCATT
  Box motif
  Complementary to target RNA
length 135
organism Homo_sapiens
snoRNA name SNORA16B
alias U98b
chromosome ⁄ contig 1
locus ⁄ host gene PPP2R5A
organization Intronic
target RNA Unknown
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved