snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD21
sequence
GCTGAATGATGATATCCCACTAACTGAGCAGTCAGTAGTTGGTCCTTTGGTTGCATATG
ATGCGATAATTGTTTCAAGACGGGACTGATGGCAGC
  Box motif
  Complementary to target RNA
length 95
organism Homo_sapiens
snoRNA name SNORD21
alias U21
chromosome ⁄ contig 1
locus ⁄ host gene RPL5
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G1303
accession no NR_000006,NT_032977
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved