snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD38A
sequence
TTCTCGTGATGAAAACTCTGTCCAGTTCTGCTACTGAAGGGAGAGAGATGAGAGCCTTT
TAGGCTGAGGAA
  Box motif
  Complementary to target RNA
length 71
organism Homo_sapiens
snoRNA name SNORD38A
alias U38A
chromosome ⁄ contig 1
locus ⁄ host gene RPS8
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A1858
accession no X97582,NT_032977
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved