snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA55
sequence
GAGCACCTGAATCTTTCCCATTCCTTGCTGCCTCGTGCCGGTGTGGGGACAGATGGTGC
TACAGAATGAGCAGAGGAAATCCAGACAGGTTGTTTTCCATTTGTCTTGGGGCCTGTCTC
TACAGCTCTGCCACATTT
  Box motif
  Complementary to target RNA
length 137
organism Homo_sapiens
snoRNA name SNORA55
alias ACA55
chromosome ⁄ contig 1
locus ⁄ host gene PABPC4
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U36
accession no AJ609480 NT_032977
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved