snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD103A
sequence
TTGTCTGGCAATGATGACCCACTTGCCCTCACTGAGAACAAAGTTCGGTAATGAGAATC
TTTGTTAATGGACTCAAGTTCTGAGCCAGACA
  Box motif
  Complementary to target RNA
length 91
organism Homo_sapiens
snoRNA name SNORD103A
alias U103
chromosome ⁄ contig 1
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site 18S:G601
accession no NR_004054,NT_032977
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved