snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD24
sequence
TGCAGATGATGTAAAAGAATATTTGCTATCTGAGAGATGGTGATGACATTTTAAACCAC
CAAGATCGCTGATGCA
  Box motif
  Complementary to target RNA
length 75
organism Homo_sapiens
snoRNA name SNORD24
alias U24
chromosome ⁄ contig 9
locus ⁄ host gene RPL7A
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:C2338,28S:C2352
accession no Z48764,NR_002447,NT_035014
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved