snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA19
sequence
GTGCACATTTCATTGACCTGCTTTCTTTTATGTGAGTAGTGTTATTTCTTATGTGCTAT
ACAAATAATTGAAGGCTAATTAGCAGTATAACTATAAATAGTAATGCTGCCAGTCTCCTT
CAGACAAAA
  Box motif
  Complementary to target RNA
length 128
organism Homo_sapiens
snoRNA name SNORA19
alias ACA19
chromosome ⁄ contig 10
locus ⁄ host gene EIF3S10
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U3618,28S:U3709,18S:U863
accession no AJ609435 NT_030059
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved