snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD7
sequence
ATGCGATGATGAGTGAAGTAGAGCCTGACCTGGTATTGCCATTGCTTCACTGTTGGCTT
TGACCAGGGTATGATCTCTTAATCTTCTCTCTGAGCTG
  Box motif
  Complementary to target RNA
length 97
organism Homo_sapiens
snoRNA name SNORD7
alias mgU6-47
chromosome ⁄ contig 17
locus ⁄ host gene Mono:266:AC015911.8
organization Mono
target RNA U6 snRNA
modification type C/D
modification site U6:A47
accession no AJ007733,NT_010799
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved