snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus SNORD14
sequence
TCGCTGTGATGAGGTCATTTCCTGCCATTCGTAGTTTCCACCTGAGGTCCAACAGACCG
GTGACGGTCCAAACCTTCCTTGGATGTCTGAGCGA
  Box motif
  Complementary to target RNA
length 94
organism Gasterosteus_aculeatus
snoRNA name SNORD14
alias
chromosome ⁄ contig groupVII
locus ⁄ host gene Poly:0:SNORD14
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved