snOPY snoRNA Orthological Gene Database
Gallus_gallus SNORD66
sequence
TTCTTGTGATGAATTCTACTTTGTGCCATCGTGTCTGGGCCACTGATACTTCATGATGG
TAAAGAGGATCTGAGGGG
  Box motif
  Complementary to target RNA
length 77
organism Gallus_gallus
snoRNA name SNORD66
alias
chromosome ⁄ contig 9
locus ⁄ host gene EIF4G1
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved