snOPY snoRNA Orthological Gene Database
Gallus_gallus SNORD38
sequence
CTTCTAATGATGATACTTCTGTCCAGTTCTGCTACTGAAGGGAGAGCGATGACACTTGT
GATGCTGAGGAAG
  Box motif
  Complementary to target RNA
length 72
organism Gallus_gallus
snoRNA name SNORD38
alias
chromosome ⁄ contig 8
locus ⁄ host gene Q6EE57_CHICK
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved