snOPY snoRNA Orthological Gene Database
Felis_catus SNORD66
sequence
TTCCGTTGATGACTTCTTGTTAGTGCCACGTGTCTGGGCCACTGAGACCGTGTGATGGA
ACTGAGGATCTGAGGAA
  Box motif
  Complementary to target RNA
length 76
organism Felis_catus
snoRNA name SNORD66
alias
chromosome ⁄ contig GeneScaffold_1174
locus ⁄ host gene Q7YS39_FELCA
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved