snOPY snoRNA Orthological Gene Database
Felis_catus SNORA25
sequence
AGATCATTTCAAAGAGGGCTTTTGGAGCTGTGAAACCAAGAGCTCTTAACTCTATGACT
AAAGGTTGAAGGTCTCCATAGGATGCCGTAGTCATTAAATAGTGCTGTTTTTCTGAGGAA
ATATAAGA
  Box motif
  Complementary to target RNA
length 127
organism Felis_catus
snoRNA name SNORA25
alias
chromosome ⁄ contig scaffold_214328
locus ⁄ host gene Mono:27:SNORA25
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved