snOPY snoRNA Orthological Gene Database
Felis_catus SNORD24
sequence
TGCTACAATGATGACATTATATTTGCTACTCTTGACTGTGAGAATGACGAGAGTTACTA
CCACCATTACACTTAACTGAGGCA
  Box motif
  Complementary to target RNA
length 83
organism Felis_catus
snoRNA name SNORD24
alias
chromosome ⁄ contig GeneScaffold_1284
locus ⁄ host gene Poly:20:SNORD78
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved