snOPY snoRNA Orthological Gene Database
Felis_catus SNORD57
sequence
TGGGGGTGATGAACTGGCTTAGCCTGACTTTGTAGAGTAGAGGCGAAAAAACTGATTTA
ATGAGCCTGATCC
  Box motif
  Complementary to target RNA
length 72
organism Felis_catus
snoRNA name SNORD57
alias
chromosome ⁄ contig scaffold_14188
locus ⁄ host gene Mono:61:SNORD57
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved