snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus SNORD82
sequence
AGCACAAATGATGAACAACAAAGGGACTTAATACTGAATCCTGATGTTACATGCAATGT
TCTGATGTGT
  Box motif
  Complementary to target RNA
length 69
organism Erinaceus_europaeus
snoRNA name SNORD82
alias
chromosome ⁄ contig GeneScaffold_2505
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved