snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus SNORA19
sequence
GTGCACATTTCATTGATCCACTTACTTCTGTTTGTGTGAGCAGTTTATTTCTTTATGTG
CTATATAAACAGATGAAGGTTAATTAACAGTATAGCCAAGTAGTTATGTTACCAGTCTCT
TTCAGACAGTT
  Box motif
  Complementary to target RNA
length 130
organism Erinaceus_europaeus
snoRNA name SNORA19
alias
chromosome ⁄ contig scaffold_185322
locus ⁄ host gene Mono:171:SNORA19
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved