snOPY snoRNA Orthological Gene Database
Equus_caballus SNORD21
sequence
GCTGAATGATGATATCCCACTCACTGAGCAGTCAGTAGTTGGTCCTTTGGTTGCATATG
ATCAATTAATTGTTTCAAGACGGGACTGATGGCAGC
  Box motif
  Complementary to target RNA
length 95
organism Equus_caballus
snoRNA name SNORD21
alias
chromosome ⁄ contig 5
locus ⁄ host gene NP_001075354.1
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved