snOPY snoRNA Orthological Gene Database
Equus_caballus SNORD14
sequence
TCACAGTGATGAATGGTCCAAACATTCGCGGTTTCCACCAGAATAACAAATGTTGGCAG
CTAGCTTCCTTCCTTGGATGTCTGAGTGA
  Box motif
  Complementary to target RNA
length 88
organism Equus_caballus
snoRNA name SNORD14
alias
chromosome ⁄ contig 7
locus ⁄ host gene HSP7C_HORSE
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved