snOPY snoRNA Orthological Gene Database
Equus_caballus SNORD38
sequence
CCTTGTGATGAAAACTGTCCAGTTCTGCTGCTGAAGGGGGAGAGATGAAAGCCTTTAGT
GCTGACGAAGG
  Box motif
  Complementary to target RNA
length 70
organism Equus_caballus
snoRNA name SNORD38
alias
chromosome ⁄ contig 2
locus ⁄ host gene ENSECAG00000015089
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved