snOPY snoRNA Orthological Gene Database
Equus_caballus SNORA16
sequence
TGTGGCCCTTATCGAAGCTGCAGCTGCTTCCACATAGCTGCTGTGGTCAAAAAGGAGCC
CAAAGTGACAGTTTTCCTCGACGGTCGCCGTTCTGTTTGCTGTAACTGATCTGCAACATT
TCAGGAAAAGACAATT
  Box motif
  Complementary to target RNA
length 135
organism Equus_caballus
snoRNA name SNORA16
alias
chromosome ⁄ contig 2
locus ⁄ host gene Poly:6:SNORA16
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved