snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORA16
sequence
TGGGACCCTTATCGAAGCTGAAGTTGCTTCCACGTAGCTGCTGTAGTCAAAAAAGAGCC
CACATTGAGTTTTTCCTTGACAGTCGCCATTCGGTTTGCTATAACCGATCTGCTACATTT
CAGGAAAAGAAATTC
  Box motif
  Complementary to target RNA
length 134
organism Echinops_telfairi
snoRNA name SNORA16
alias
chromosome ⁄ contig scaffold_244974
locus ⁄ host gene Mono:387:SNORA16
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved