snOPY snoRNA Orthological Gene Database
Echinops_telfairi SNORD57
sequence
GGGAGTTGACCTTGTAAAGTGAAGGCAAAAACACTGATTTAATTAGCCTGATCC
  Box motif
  Complementary to target RNA
length 54
organism Echinops_telfairi
snoRNA name SNORD57
alias
chromosome ⁄ contig scaffold_284314
locus ⁄ host gene Mono:299:SNORD57
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved