snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:MeU6-A47
sequence
AGCCAATGATGATTAAACCACAAATGCAGGGAGTGGGCAGCTGGCAACAGTTGGCGCAC
GCATGACCAGCAACTAATCTTCTCGCTGACGG
  Box motif
  Complementary to target RNA
length 91
organism Drosophila_melanogaster
snoRNA name snoRNA:MeU6-A47
alias
chromosome ⁄ contig X
locus ⁄ host gene Hlc
organization Intronic
target RNA U6 snRNA
modification type C/D
modification site U6:A47
accession no AE014298 ,NR_002137
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved