snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Psi18S-525g
sequence
TAGGAGCCAAAGTGGCATGCCTTGGAACTTTTATCCAATTTGTGTCTCTAATGCTCCGA
TACTAATTATACAAACGAACGGCATCCTGTTTGATCCTACATATCACAATAGATGACTTG
AGTTCGTGTACATTA
  Box motif
  Complementary to target RNA
length 134
organism Drosophila_melanogaster
snoRNA name snoRNA:Psi18S-525g
alias
chromosome ⁄ contig 2L
locus ⁄ host gene Arc-p34
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U525
accession no NR_003774,AE014134
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved