snOPY snoRNA Orthological Gene Database

Family: snoRNA:Psi18S-525

CLUSTAL 2.0.10 multiple sequence alignment D_melanogaster300042 ---TAGGAGGCAAAGTGGCATATTTGGGAATATACCTTCCCAATTGTGTCTCAAATACTC D_melanogaster300056 -TTGTGGAACAAAAGTGGCATACTTGGAA-AAAATCTCCTG--TTGTGTCTCAAATGTTC D_melanogaster300058 --TTTGGAGCCAAAGTGGCATTCTTCAAA-AACAATATTTGATCTGTGTCTCAAAAGCTC D_melanogaster300059 ---CTGGAGTCAAAGTGGCACGTCTTACG-ATCTTCCTGTAACTTGTGTCTCAAATGCTC D_melanogaster300061 TGGGTGGAGTTAAAGTGGCATATTTTATA-GCTTTCCTTTGATCTGTGTCTCTATCGCTC D_melanogaster300063 ---TTGGAGTCAAAGTGGCACACTT---A-ATCCATTTTTA-TTTGTGTCTCAAATGCTC D_melanogaster300065 ---GTGGAGGTAAAGTGGCATTCTCGGGA-TATATAAACCTGCCTGTGTCTCAAACACTC D_melanogaster300066 ---TAGGAGCCAAAGTGGCATGCCTTGGA-ACTTTTATCCAATTTGTGTCTCTAATGCTC D_melanogaster300068 -CTGTGGAGTCAAAGTGGCATGTTTTA-A-ATTACAATTTGAATTGTGTCTCAAATGCTC D_melanogaster300070 --TATGGAGTTAAAGTGGCATATTTTTAATACTTACCCTAAATCTGTGTCTCTAAAGCTC D_melanogaster300072 --AATGGAGTTAAAGTGGCATATTTTGTATACCTTCCTTCAATTTGTGTCTCTAATGCTC *** ********* ******** * ** D_melanogaster300042 CAAAAACAACTATGTAATAGGGACGAACGGCATCCTGAATAGTGCATCATACTATAGCAG D_melanogaster300056 CAAAATAAACCAAAAG-----GACGAACGGCATCCTGAATAATCAATCATATTATAGCAG D_melanogaster300058 CAACATTAACTAGAAA-----GACGAACGGCATCCTGAATAATCAATCATATTATAACAG D_melanogaster300059 CAATATCAAACGAAAG-----GACGAACGGCATCCTGAATAATCAATCATATTATAGCAG D_melanogaster300061 CAATATCAATTTTATA-----AGCGAACGGCATCCTGTTTAATTACTTATATTAAGACAG D_melanogaster300063 CAATATCAAATGCAAA-----GGCGAACGGCATCCTGAATAATTATGCATATTATAACAG D_melanogaster300065 CCAAATCAACTTGGTT-----GGCGAACGGCATCCTGAGTAATTAATAATATTACATCAG D_melanogaster300066 CGATACTAATTATACA-----AACGAACGGCATCCTGTTTGATCCTACATATCACAATAG D_melanogaster300068 CAATATCAACAAGATA-----TGCGAACGGCATCCTGAATAATCAATCATATTATAGCAG D_melanogaster300070 CAATATTAAATAAATA-----GACAATCGGCATCCTGAATAATCAATCATATTATAGCAG D_melanogaster300072 CAATATTAAATAAGTA-----GACGAACGGCATCCTGAATAATCAATCATATTATCGCAG * * * ** * * ********** * * *** * ** D_melanogaster300042 ATGACTTGTGTTCGTGCACATGT- D_melanogaster300056 ATGACTTGTGTTCGTGTACATAA- D_melanogaster300058 ATGACTTGTGTTCGTGTACATTT- D_melanogaster300059 ATGACTTGTGTTCGACTACAATA- D_melanogaster300061 ACGACTTGTGTTCGTGCACAACT- D_melanogaster300063 ATGACTTGTGTTCGCCTACAATA- D_melanogaster300065 ATGACTTGAGTTCGCGCACAATCG D_melanogaster300066 ATGACTTGAGTTCGTGTACATTA- D_melanogaster300068 ATGACTTGTGTTTGTGTACAGTA- D_melanogaster300070 ATGACTTGTGTTTGTGTACAGTA- D_melanogaster300072 ATGACTTGTGTTTGTGTACAGTA- * ****** *** * ***

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved