snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORA16
sequence
AAGACCCCAAATAAACACCTTTGTTGCCTTGCAAAAAAAAAAAAAAGGAGCCCAGAGTG
ACAGTTTTCCTTGACGGTCGCTGTTCTGTTTGCTGTAACTTATCTGCAACGATTTCGGGA
AAAGACAGTT
  Box motif
  Complementary to target RNA
length 129
organism Dasypus_novemcinctus
snoRNA name SNORA16
alias
chromosome ⁄ contig scaffold_217422
locus ⁄ host gene Poly:14:SNORA16
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved