snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORD38
sequence
CTTCTTGTGATGAAAACTCTGTCCAGTTCTGCTTCTGAAGGGAAAGAGATGAAGCATTT
AGTGCTGAGGAAG
  Box motif
  Complementary to target RNA
length 72
organism Dasypus_novemcinctus
snoRNA name SNORD38
alias
chromosome ⁄ contig GeneScaffold_2490
locus ⁄ host gene Poly:19:SNORD55
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved