snOPY snoRNA Orthological Gene Database
Danio_rerio SNORA19
sequence
GTGCACATTTCATTGTCCCATTCTTCCCATGTAAGAACTGAGATATTTCTTATGTGCTA
GATAAACTCTGGAGGTAAATTAGCAGTTTGGCTTCATTGTGCCTCACTGCCAGTCCCCTT
CATACAATA
  Box motif
  Complementary to target RNA
length 128
organism Danio_rerio
snoRNA name SNORA19
alias
chromosome ⁄ contig 7.0
locus ⁄ host gene rps13
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site
accession no NC_007118.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved