snOPY snoRNA Orthological Gene Database
Ciona_savignyi SNORD14
sequence
CTGCAATGATGATGTATCCCAACATTCGCAGTTTCCACCAGACCAGAGATAAACTTAAT
ATACAGGAGGGTAAAACTTGCTGTATATTATGTTGATTCTCGATTTATGATGGTTTAATG
TTCCTTCCTTGGATGTCTGAGCAG
  Box motif
  Complementary to target RNA
length 143
organism Ciona_savignyi
snoRNA name SNORD14
alias
chromosome ⁄ contig reftig_11
locus ⁄ host gene ENSCSAVG00000002810
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved