snOPY snoRNA Orthological Gene Database
Ciona_intestinalis SNORD14
sequence
CTGCTATGATGATGTATTCCAACATTCGCAGTTTCCACCAGACCGAGATAAACTTAATA
TACAGGAAGGTAAAACTTGCTGTATATTAAGCCAACTCTCATTAATGATGGTTTAACGTT
CCTTCCTTGGATGTCTGAGCAG
  Box motif
  Complementary to target RNA
length 141
organism Ciona_intestinalis
snoRNA name SNORD14
alias
chromosome ⁄ contig 3q
locus ⁄ host gene ENSCING00000012576
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved