snOPY snoRNA Orthological Gene Database
Ciona_intestinalis SNORD24
sequence
AGACTATGATGTTACATATATTTGCTATCTGAATCAATGTGGACAACCCACCAAGATCG
CTGAGTCT
  Box motif
  Complementary to target RNA
length 67
organism Ciona_intestinalis
snoRNA name SNORD24
alias
chromosome ⁄ contig 3p
locus ⁄ host gene ENSCING00000009395
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved