snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORA19
sequence
ATGCACATTTCATTGACCTGCTTTCTTTCATATATGTGAGCAGTGTTATTTCTTATGTG
CTATACAAATATTTGAAGGTTAATTAGCAGAATAACTATAAATAGTAATGCTGCCAGTCT
CCTTCAGACAGAA
  Box motif
  Complementary to target RNA
length 132
organism Cavia_porcellus
snoRNA name SNORA19
alias
chromosome ⁄ contig scaffold_1
locus ⁄ host gene EIF3A
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved