snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORA16
sequence
GGTGGCCCTTATCGAAGCTGCAGCTGCTTGTACATAGTTGCTGCAGTCAAAAAGGAGCC
CAGAGTAAGAATTTTCCTTGATGGTTGCCGTTCTGTTTGCTGTAACTGATCTGCAACATT
TTGGGGAAAGACAGTT
  Box motif
  Complementary to target RNA
length 135
organism Cavia_porcellus
snoRNA name SNORA16
alias
chromosome ⁄ contig scaffold_221515
locus ⁄ host gene Mono:355:SNORA16
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved