snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORA16
sequence
ATTAGAATCAAAGATGCAGTTGCTTTCACATAGAAGCAGCAGTCAGAAAAGAGCCTAAA
TGACAGTTTTCCTATTCAACCACTGTTCTGTTGTCTGTAACTGACTTATGACATGTTGGA
AAACACAGCT
  Box motif
  Complementary to target RNA
length 129
organism Canis_familiaris
snoRNA name SNORA16
alias
chromosome ⁄ contig 25
locus ⁄ host gene Mono:65:SNORA16
organization Mono
target RNA 28S rRNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved