snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORA25
sequence
AGATCATTTTAAAGGAAGCTTGTGGGGCTGTGAAATCAGAAACTCTAACCCTATCACCA
AAGACTGAAGTTCTGCATAGGATGCCACAGAACTCAACAGCAATGTTTTCCTGTTCCTTC
CAAGGCATATGC
  Box motif
  Complementary to target RNA
length 131
organism Canis_familiaris
snoRNA name SNORA25
alias
chromosome ⁄ contig 4
locus ⁄ host gene Mono:37:SNORA25
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved