snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORA19
sequence
TTGCACAAAGAAAGGAGAGGATAAAAGAGAGAACCAGTATGTAAGCAGTGCTATTTCTA
ATGTGCTACAAAGGGTTGAAGGGTAATTAGCAGTATAACTAAACAATCATCTGCCAGTCT
CCTTCAGACAAAC
  Box motif
  Complementary to target RNA
length 132
organism Canis_familiaris
snoRNA name SNORA19
alias
chromosome ⁄ contig 31
locus ⁄ host gene Mono:107:SNORA19
organization Mono
target RNA 28S rRNA, 18S rRNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved