snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans H06I04.8
sequence
CGATGATGATGAAGAATTTTTGATATGGTGTCAGGACCTCTGAGAGTTCCGTGATGATG
TTTAGAGTTCCTGAATCTT
  Box motif
  Complementary to target RNA
length 78
organism Caenorhabditis_elegans
snoRNA name H06I04.8
alias CeN106
chromosome ⁄ contig III
locus ⁄ host gene ubl-1
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:C1180
accession no AM050290,NR_003430
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved