snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Y71D11A.7
sequence
AAAAAGTCAATGATGTTTTTTCAAGACGGGACCGACTGGTGAATGATGCATAAATGAAA
TGCTGAGACTTTTT
  Box motif
  Complementary to target RNA
length 73
organism Caenorhabditis_elegans
snoRNA name Y71D11A.7
alias CeN13
chromosome ⁄ contig III
locus ⁄ host gene Y71D11A.3
organization Intronic
target RNA 26S rRNA
modification type C/D
modification site 26S:G668
accession no AM050838,NR_002654
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved